Quick Start¶
This guide will help you get started with DNALLM quickly. DNALLM is a comprehensive, open-source toolkit designed for fine-tuning and inference with DNA Language Models.
Prerequisites¶
- Python 3.10 or higher (Python 3.12 recommended)
- Git
- CUDA-compatible GPU (optional, for GPU acceleration)
- Environment Manager: Choose one of the following:
- Python venv (built-in)
- Conda/Miniconda (recommended for scientific computing)
Installation¶
Quick Installation with uv (Recommended)¶
DNALLM uses uv for dependency management and packaging.
What is uv is a fast Python package manager that is 10-100x faster than traditional tools like pip.
Method 1: Using venv + uv¶
# Clone repository
git clone https://github.com/zhangtaolab/DNALLM.git
cd DNALLM
# Create virtual environment
python -m venv .venv
# Activate virtual environment
source .venv/bin/activate # Linux/MacOS
# or
.venv\Scripts\activate # Windows
# Upgrade pip (recommended)
pip install --upgrade pip
# Install uv in virtual environment
pip install uv
# Install DNALLM with base dependencies
uv pip install -e '.[base]'
# Verify installation
python -c "import dnallm; print('DNALLM installed successfully!')"
Method 2: Using conda + uv¶
# Clone repository
git clone https://github.com/zhangtaolab/DNALLM.git
cd DNALLM
# Create conda environment
conda create -n dnallm python=3.12 -y
# Activate conda environment
conda activate dnallm
# Install uv in conda environment
conda install uv -c conda-forge
# Install DNALLM with base dependencies
uv pip install -e '.[base]'
# Verify installation
python -c "import dnallm; print('DNALLM installed successfully!')"
GPU Support¶
For GPU acceleration, install the appropriate CUDA version:
# For venv users: activate virtual environment
source .venv/bin/activate # Linux/MacOS
# or
.venv\Scripts\activate # Windows
# For conda users: activate conda environment
# conda activate dnallm
# CUDA 12.4 (recommended for recent GPUs)
uv pip install -e '.[cuda124]'
# Other supported versions: cpu, cuda121, cuda126, cuda128
uv pip install -e '.[cuda121]'
Native Mamba Support¶
Native Mamba architecture runs significantly faster than transformer-compatible Mamba architecture, but native Mamba depends on Nvidia GPUs.
If you need native Mamba architecture support, after installing DNALLM dependencies, use the following command:
# For venv users: activate virtual environment
source .venv/bin/activate # Linux/MacOS
# or
.venv\Scripts\activate # Windows
# For conda users: activate conda environment
# conda activate dnallm
# Install Mamba support
uv pip install -e '.[mamba]' --no-cache-dir --no-build-isolation
Please ensure your machine can connect to GitHub, otherwise Mamba dependencies may fail to download.
Basic Usage¶
1. Basic Model Loading and Inference¶
from dnallm import load_config, load_model_and_tokenizer
from dnallm.inference import DNAInference
# Load configuration
configs = load_config("./example/notebooks/inference/inference_config.yaml")
# Load model and tokenizer
model_name = "zhangtaolab/plant-dnagpt-BPE-promoter"
model, tokenizer = load_model_and_tokenizer(
model_name,
task_config=configs["task"],
source="huggingface"
)
# Initialize inference engine
inference_engine = DNAInference(config=configs, model=model, tokenizer=tokenizer)
# Make inference
sequence = "TCACATCCGGGTGAAACCTCGAGTTCCTATAACCTGCCGACAGGTGGCGGGTCTTATAAAACTGATCACTACAATTCCCAATGGAAAAAAAAAAAAAAAAACCCTTATTTGACTCTCATTATAGATCAACGATGGATCTAGCTCTTCTTTTGTAATTACCTGACTTTTGACCTGACGAACCAAGTTATCGGTTGGGGCCCTGTCAAACGACAGGTCGCTTAGAGGGCATATGTGAGAAAAAGGGTCCTGTTTTTTATCCACGGAGAAAGAAAGCAAGAAGAGGAGAGGTTTTAAAAAAAA"
inference_result = inference_engine.infer(sequence)
print(f"Inference result: {inference_result}")
2. In-silico Mutagenesis Analysis¶
from dnallm import load_config
from dnallm.inference import Mutagenesis
# Load configuration
configs = load_config("./example/notebooks/in_silico_mutagenesis/inference_config.yaml")
# Load model and tokenizer
model_name = "zhangtaolab/plant-dnagpt-BPE-promoter_strength_protoplast"
model, tokenizer = load_model_and_tokenizer(
model_name,
task_config=configs["task"],
source="huggingface"
)
# Initialize mutagenesis analyzer
mutagenesis = Mutagenesis(config=configs, model=model, tokenizer=tokenizer)
# Generate saturation mutations
sequence = "AATATATTTAATCGGTGTATAATTTCTGTGAAGATCCTCGATACTTCATATAAGAGATTTTGAGAGAGAGAGAGAACCAATTTTCGAATGGGTGAGTTGGCAAAGTATTCACTTTTCAGAACATAATTGGGAAACTAGTCACTTTACTATTCAAAATTTGCAAAGTAGTC"
mutagenesis.mutate_sequence(sequence, replace_mut=True)
# Evaluate mutation effects
predictions = mutagenesis.evaluate(strategy="mean")
# Visualize results
plot = mutagenesis.plot(predictions, save_path="mutation_effects.pdf")
3. Model Fine-tuning¶
from dnallm import load_config
from dnallm.datahandling import DNADataset
from dnallm.finetune import DNATrainer
# Load configuration
configs = load_config("./example/notebooks/finetune_binary/finetune_config.yaml")
# Load model and tokenizer
model_name = "zhangtaolab/plant-dnabert-BPE"
model, tokenizer = load_model_and_tokenizer(
model_name,
task_config=configs["task"],
source="huggingface"
)
# Prepare dataset
dataset = DNADataset.load_local_data(
file_paths="./tests/test_data/binary_classification/train.csv",
seq_col="sequence",
label_col="label",
tokenizer=tokenizer,
)
# Encode the sequences in the dataset
dataset.encode_sequences()
# Initialize trainer
trainer = DNATrainer(
config=configs,
model=model,
datasets=dataset
)
# Start training
trainer.train()
4. Models Benchmark¶
from dnallm import load_config
from dnallm.inference import Benchmark
# Load configuration
configs = load_config("./example/notebooks/benchmark/benchmark_config.yaml")
# Initialize benchmark
benchmark = Benchmark(config=configs)
# Run benchmark
results = benchmark.run()
# Display results
for dataset_name, dataset_results in results.items():
print(f"\n{dataset_name}:")
for model_name, metrics in dataset_results.items():
print(f" {model_name}:")
for metric, value in metrics.items():
if metric not in ["curve", "scatter"]:
print(f" {metric}: {value:.4f}")
# Plot metrics
# pbar: bar chart for all the scores, pline: ROC curve
pbar, pline = benchmark.plot(results, save_path="plot.pdf")
Examples and Tutorials¶
Interactive Demos (Marimo)¶
# Launch Jupyter Lab
uv run jupyter lab
# Launch Marimo
uv run marimo run xxx.py
# Fine-tuning demo
uv run marimo run example/marimo/finetune/finetune_demo.py
# Inference demo
uv run marimo run example/marimo/inference/inference_demo.py
# Benchmark demo
uv run marimo run example/marimo/benchmark/benchmark_demo.py
Jupyter Notebooks¶
# Launch Jupyter Lab
uv run jupyter lab
# Available notebooks:
# - example/notebooks/finetune_binary/ - Binary classification fine-tuning
# - example/notebooks/finetune_multi_labels/ - Multi-label classification
# - example/notebooks/finetune_NER_task/ - Named Entity Recognition
# - example/notebooks/inference/ - Model inference
# - example/notebooks/in_silico_mutagenesis/ - Mutation analysis
# - example/notebooks/embedding_attention.ipynb - Embedding and attention analysis
# - example/notebooks/generation_evo_models/ - EVO model inference
# - example/notebooks/lora_finetune_inference/ - LoRA fine-tuning
Command Line Interface¶
DNALLM provides convenient CLI tools:
# Training
dnallm-train --config path/to/config.yaml
# Inference
dnallm-inference --config path/to/config.yaml --input path/to/sequences.txt
# Model configuration generator
dnallm-model-config-generator
# MCP server
dnallm-mcp-server --config path/to/config.yaml
Supported Task Types¶
DNALLM supports the following task types:
- EMBEDDING: Extract embeddings, attention maps, and token probabilities for downstream analysis
- MASK: Masked language modeling task for pre-training
- GENERATION: Text generation task for causal language models
- BINARY: Binary classification task with two possible labels
- MULTICLASS: Multi-class classification task that specifies which class the input belongs to (more than two)
- MULTILABEL: Multi-label classification task with multiple binary labels per sample
- REGRESSION: Regression task which returns a continuous score
- NER: Token classification task which is usually for Named Entity Recognition
Next Steps¶
- Explore the API documentation for detailed function references
- Check out user guides for specific use cases
- Visit the FAQ for common questions
- Join the community discussions on GitHub
Need More Details?¶
- See Installation Guide for complete dependency information, including:
- All available dependency groups (base, dev, test, notebook, docs, mcp)
- Hardware-specific groups (cpu, cuda121, cuda124, cuda126, cuda128, rocm, mamba)
- Installation scenarios for different use cases
- Troubleshooting common issues
Need Help?¶
- Documentation: Browse the complete documentation
- Issues: Report bugs or request features on GitHub
- Examples: Check the example notebooks for working code
- Configuration: Refer to the configuration examples in the docs