Using Caduceus Models in DNALLM¶
Caduceus is a family of bi-directional and equivariant models designed specifically for long-range DNA sequence modeling. It introduces architectural innovations to handle the unique symmetries of DNA, such as reverse-complement equivariance, making it particularly powerful for genomics.
DNALLM Examples: Caduceus-Ph, Caduceus-PS, PlantCaduceus, PlantCAD2
1. Architecture Overview¶
Caduceus models are built on a custom architecture that modifies the standard Transformer to better suit DNA.
- Reverse-Complement Equivariance: The model is designed to produce equivalent representations for a DNA sequence and its reverse complement. This is a natural inductive bias for DNA, as functionality is often preserved in both strands.
- Bi-directional Long-Range Modeling: It processes sequences bi-directionally and is optimized to handle very long DNA contexts, which is essential for capturing distal regulatory elements.
- Masked Language Modeling: Like BERT, Caduceus is pre-trained using a masked language modeling objective, where it learns to predict masked nucleotides within a long sequence.
These features make Caduceus highly effective for tasks requiring an understanding of long-range dependencies in genomes.
2. Environment and Installation¶
Caduceus models are supported by the standard transformers library and do not require any special dependencies beyond the core DNALLM installation.
Installation¶
A standard DNALLM installation is sufficient.
# Install DNALLM with core dependencies
pip install dnallm
3. Model Loading and Configuration¶
You can load a Caduceus model using the AutoModel classes from transformers or the DNALLM utility functions.
Loading a Model¶
Here’s how to load a Caduceus model for a masked language modeling task.
from dnallm.utils.load import load_model_and_tokenizer
# Use a specific Caduceus model
model_name = "kuleshov-group/caduceus-ph_seqlen-131k_d_model-256_n_layer-16"
# Load model and tokenizer
model, tokenizer = load_model_and_tokenizer(model_name_or_path=model_name)
print("Model:", type(model))
print("Tokenizer:", type(tokenizer))
4. Inference Example¶
Let's use a Caduceus model to get embeddings for a DNA sequence.
import torch
from dnallm.utils.load import load_model_and_tokenizer
# 1. Load the pre-trained model and tokenizer
model_name = "kuleshov-group/PlantCaduceus_l20"
model, tokenizer = load_model_and_tokenizer(model_name)
model.eval()
# 2. Prepare and tokenize the DNA sequence
dna_sequence = "GATTACAGATTACAGATTACAGATTACAGATTACAGATTACA"
inputs = tokenizer(dna_sequence, return_tensors="pt")
# 3. Perform inference
with torch.no_grad():
outputs = model(**inputs)
embeddings = outputs.last_hidden_state
print("Shape of embeddings:", embeddings.shape)