Skip to content

Using ESM Models in DNALLM

ESM (Evolutionary Scale Modeling) models are a family of protein language models adapted for genomics. While originally trained on protein sequences, their Transformer-encoder architecture is highly effective for DNA, and they have been successfully fine-tuned for various nucleotide tasks. Models like the Nucleotide Transformer and AgroNT are prominent examples of this approach.

DNALLM Examples: Nucleotide Transformer, AgroNT (adapted for DNA)

1. Architecture Overview

ESM models are based on the Transformer encoder architecture, similar to BERT.

  • Bidirectional Context: Like BERT, ESM models process the entire sequence at once, capturing rich contextual information.
  • Pre-trained on Biology: ESM models were pre-trained on massive datasets of protein sequences, learning fundamental biological patterns that can be transferred to DNA.
  • Focus on Embeddings: They are particularly renowned for producing high-quality embeddings that represent functional and structural properties of sequences.

In the context of DNALLM, ESM models are treated as powerful feature extractors. Their pre-trained knowledge provides a strong starting point for fine-tuning on specific genomic tasks.

2. Environment and Installation

ESM models are supported by the standard transformers library and do not require any special dependencies beyond the core DNALLM installation.

Installation

A standard DNALLM installation is sufficient.

# Install DNALLM with core dependencies
pip install dnallm

3. Model Loading and Configuration

You can load an ESM model adapted for DNA using the AutoModel classes from transformers or the DNALLM utility functions.

Loading a Model

Here’s how to load an ESM model for a DNA classification task. Note that we use a version that has been fine-tuned or adapted for nucleotide data.

from transformers import AutoModelForMaskedLM, AutoTokenizer

# Use a specific Nucleotide Transformer model
model_name = "InstaDeepAI/nucleotide-transformer-v2-100m-multi-species"

# Load model and tokenizer
# The DNALLM utility handles the model type detection automatically for ESM-based models
model, tokenizer = load_model_and_tokenizer(
    model_name_or_path=model_name,
    model_type="esm",
    num_labels=2,  # Example for binary classification
    trust_remote_code=True,
)

print("Model:", type(model))
print("Tokenizer:", type(tokenizer))

Important: When using ESM for DNA, you typically replace its original amino acid tokenizer with a nucleotide tokenizer (e.g., one for k-mers). The fine-tuning process adapts the model's weights to the new vocabulary.

4. Inference Example

Let's use the loaded Nucleotide Transformer to get embeddings for a DNA sequence.

import torch
from dnallm.utils.load import load_model_and_tokenizer

# 1. Load the model and its specific tokenizer
model_name = "InstaDeepAI/nucleotide-transformer-v2-100m-multi-species"
model, tokenizer = load_model_and_tokenizer(model_name_or_path=model_name)
model.eval()

# 2. Prepare and tokenize the DNA sequence
dna_sequence = "GATTACAGATTACAGATTACAGATTACAGATTACAGATTACA"
inputs = tokenizer(dna_sequence, return_tensors="pt")

# 3. Perform inference
with torch.no_grad():
    outputs = model(**inputs)

# The last hidden state contains the contextual embeddings for each token
embeddings = outputs.last_hidden_state
print("Shape of embeddings:", embeddings.shape)

5. Common Issues and Solutions

  1. Tokenizer Mismatch:

    • Issue: The default ESM tokenizer is for amino acids, not nucleotides. Using it directly with DNA will fail.
    • Solution: You must use a nucleotide-based tokenizer. When fine-tuning, you need to resize the model's token embeddings to match the new vocabulary size of the DNA tokenizer. The DNALLM fine-tuning script handles this automatically.
  2. Poor Performance on DNA Tasks Out-of-the-Box:

    • Issue: An ESM model pre-trained only on proteins will not perform well on DNA tasks without fine-tuning.
    • Solution: Fine-tuning is essential. The model must learn to apply its learned representations to the new domain of genomics. Use the DNALLM finetune CLI for this purpose.

Next: Compare with other encoder models like BERT-based Models.