Using HyenaDNA Models in DNALLM¶
HyenaDNA is a class of genomic foundation models designed for long-range sequence modeling at single-nucleotide resolution. It is notable for its attention-free architecture, which replaces the quadratic-cost attention mechanism of Transformers with long convolutions. This allows it to scale to extremely long sequences (up to 1 million tokens).
DNALLM Examples: HyenaDNA
1. Architecture Overview¶
HyenaDNA is based on the Hyena operator, a sub-quadratic alternative to attention.
- Attention-Free: Instead of using self-attention, HyenaDNA relies on implicit long convolutions parameterized by a small neural network. This design choice significantly reduces computational complexity from O(N²) to O(N log N), where N is the sequence length.
- Causal Language Modeling: It is pre-trained as a causal (autoregressive) language model, meaning it predicts the next nucleotide in a sequence given the preceding ones.
- Single-Nucleotide Resolution: The model operates directly on single characters (A, C, G, T, N), avoiding k-mer tokenization and preserving the full resolution of the genomic sequence.
This architecture makes HyenaDNA exceptionally well-suited for tasks involving very long-range dependencies, such as modeling entire genes or regulatory regions.
2. Environment and Installation¶
HyenaDNA models require specific dependencies that are not part of the standard DNALLM installation.
Installation¶
You need to install causal-conv1d and other related packages.
# Install DNALLM
pip install dnallm
# Install HyenaDNA dependencies
pip install causal-conv1d>=1.1.0
3. Model Loading and Configuration¶
You can load a HyenaDNA model using the custom HyenaDNAForCausalLM class or through the DNALLM utility functions.
Loading a Model¶
Here’s how to load a HyenaDNA model for a causal language modeling task.
from dnallm.utils.load import load_model_and_tokenizer
# Use a specific HyenaDNA model
model_name = "LongSafari/hyenadna-small-32k-seqlen-hf"
# Load model and tokenizer
model, tokenizer = load_model_and_tokenizer(model_name_or_path=model_name)
print("Model:", type(model))
print("Tokenizer:", type(tokenizer))
4. Inference Example¶
Let's use a HyenaDNA model to get embeddings for a DNA sequence.
import torch
from dnallm.utils.load import load_model_and_tokenizer
# 1. Load the pre-trained model and tokenizer
model_name = "LongSafari/hyenadna-tiny-1k-seqlen-hf"
model, tokenizer = load_model_and_tokenizer(model_name)
model.eval()
# 2. Prepare and tokenize the DNA sequence
dna_sequence = "GATTACAGATTACAGATTACAGATTACAGATTACAGATTACA"
inputs = tokenizer(dna_sequence, return_tensors="pt")
# 3. Perform inference
with torch.no_grad():
outputs = model(**inputs)
embeddings = outputs.hidden_states[
-1
] # Hyena outputs hidden states differently
print("Shape of embeddings:", embeddings.shape)