Using Llama-based Models in DNALLM¶
Llama (Large Language Model Meta AI) is a family of powerful, open-source large language models. While originally trained on natural language text, their versatile Transformer decoder architecture has been successfully adapted for genomic sequence modeling. These models are typically used for causal (autoregressive) tasks like sequence generation.
DNALLM Examples: GENERator, OmniNA
1. Architecture Overview¶
Llama-based models are decoder-only Transformers.
- Causal (Autoregressive) Modeling: These models are trained to predict the next token in a sequence based on all previous tokens. This makes them naturally suited for sequence generation tasks.
- Unidirectional Context: Unlike BERT, which is bidirectional, Llama models only consider the left-side context when generating a representation for a token.
- Architectural Refinements: Llama includes several improvements over the original Transformer, such as pre-normalization (RMSNorm), SwiGLU activation functions, and Rotary Position Embeddings (RoPE), which contribute to its strong performance and training stability.
In DNALLM, Llama-based models are excellent for tasks like generating novel DNA sequences with desired properties or for scoring sequences based on their learned probability distribution.
2. Environment and Installation¶
Llama-based models are supported by the standard transformers library and do not require any special dependencies beyond the core DNALLM installation.
Installation¶
A standard DNALLM installation is sufficient.
# Install DNALLM with core dependencies
pip install dnallm
3. Model Loading and Configuration¶
You can load a Llama-based DNA model using the AutoModelForCausalLM class from transformers or the DNALLM utility functions.
Loading a Model¶
Here’s how to load a Llama-based model for a causal language modeling task.
from dnallm.utils.load import load_model_and_tokenizer
# Use a specific Llama-based DNA model
model_name = "GenerTeam/GENERator-eukaryote-1.2b-base"
# Load model and tokenizer
model, tokenizer = load_model_and_tokenizer(model_name_or_path=model_name)
print("Model:", type(model))
print("Tokenizer:", type(tokenizer))
4. Inference Example¶
Let's use a Llama-based model to get embeddings for a DNA sequence.
import torch
from dnallm import load_model_and_tokenizer
# 1. Load the pre-trained model and tokenizer
model_name = "XLS/OmniNA-66m"
model, tokenizer = load_model_and_tokenizer(model_name)
model.eval()
# 2. Prepare and tokenize the DNA sequence
dna_sequence = "GATTACAGATTACAGATTACAGATTACAGATTACAGATTACA"
inputs = tokenizer(dna_sequence, return_tensors="pt")
# 3. Perform inference
with torch.no_grad():
outputs = model(**inputs, output_hidden_states=True)
embeddings = outputs.hidden_states[-1]
print("Shape of embeddings:", embeddings.shape)