Skip to content

Supported Data Formats and Conversion

The DNADataset class in DNALLM is highly flexible and can load data from a wide variety of formats. This guide covers the most common formats and provides examples for loading and converting them.

1. Supported Data Formats

The DNADataset.load_local_data() method can handle:

  • Tabular Files: csv, tsv
  • Structured Files: json, jsonl
  • High-Performance Formats: arrow, parquet
  • Raw Sequence Files: fasta, txt
  • In-Memory Objects: Python dict or list of dictionaries.

For security and compatibility reasons, loading directly from pickle files is not supported, but you can easily convert them.

2. Loading Standard Formats

For most file-based formats, you can use the DNADataset.load_local_data() class method. The key is to specify the column names for your sequences and labels if they differ from the defaults (sequence and label).

CSV / TSV

from dnallm.datahandling.data import DNADataset

# Assuming 'my_data.csv' has columns 'dna_string' and 'target'
dna_ds = DNADataset.load_local_data(
    "my_data.csv",
    seq_col="dna_string",
    label_col="target"
)
print(dna_ds)

JSONL Format: Create a file named train.jsonl. Each line is a JSON object.

// file: my_dataset/train.jsonl
{"sequence": "GATTACAGATTACAGATTACAGATTACA", "label": 1}
{"sequence": "CGCGCGCGCGCGCGCGCGCGCGCGCGCG", "label": 0}
{"sequence": "AAATTTCCGGGAAATTTCCGGGAAATTT", "label": 1}

For Pre-training

A simple text file where each line is a sequence is sufficient.

# file: my_corpus.txt
GATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACAGATTACA...
CGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGCGC...

3. Conversion Example: FASTA to CSV

Often, you will have your sequences in a FASTA file and your labels in a separate file. The dnallm.datahandling.data module provides a fasta_to_df utility to easily parse FASTA files into a pandas DataFrame, which you can then merge with your labels.

Let's assume you have sequences.fa and labels.csv (with a name column matching the FASTA headers and a label column).

import pandas as pd
from dnallm.datahandling.data import fasta_to_df

# Example usage
fasta_path = "sequences.fa"
labels_path = "labels.csv"
output_path = "train_dataset.csv"

# 1. Load sequences from FASTA into a DataFrame
# The 'name' column will contain the sequence headers from the FASTA file.
seq_df = fasta_to_df(fasta_path) # Columns: 'name', 'sequence'

# 2. Load labels and merge with sequences based on the name
label_df = pd.read_csv(labels_path)
merged_df = pd.merge(seq_df, label_df, on="name")

# 3. Save the final dataset to a CSV file
merged_df[["sequence", "label"]].to_csv(output_path, index=False)
print("Conversion complete!")

4. Loading Other Formats (Arrow, Parquet, Pickle)

The DNALLM DNADataset class can directly load data from several high-performance formats like Apache Arrow and Parquet. This is often more efficient than using CSV, especially for large datasets.

Loading Arrow or Parquet Files

If your data is already in Arrow or Parquet format with sequence and label columns, you can load it directly.

from dnallm.datahandling.data import DNADataset

# Load from a Parquet file
dna_ds_from_parquet = DNADataset.load_local_data("my_dataset.parquet")

# Load from an Arrow file
dna_ds_from_arrow = DNADataset.load_local_data("my_dataset.arrow")

print(dna_ds_from_parquet)

Converting from Pickle to a Supported Format

While DNADataset doesn't load Pickle files directly for security and compatibility reasons, you can easily convert them using pandas.

Let's say you have a data.pkl file containing a list of dictionaries or a pandas DataFrame.

import pandas as pd

# 1. Load the data from the Pickle file
data = pd.read_pickle("my_dataset.pkl")

# 2. Convert to a pandas DataFrame if it's not already
df = pd.DataFrame(data)

# 3. Save to a supported format like CSV or Parquet
df[["sequence", "label"]].to_csv("converted_dataset.csv", index=False)
# Or for better performance:
# df[["sequence", "label"]].to_parquet("converted_dataset.parquet")

---

## Next Steps

- [Data Preparation](data_preparation.md) - Learn about data collection and organization
- [Data Augmentation](data_augmentation.md) - Learn about data augmentation techniques
- [Quality Control](quality_control.md) - Ensure data quality and consistency
- [Data Processing Troubleshooting](../../faq/data_processing_troubleshooting.md) - Common data processing issues and solutions
```