Skip to content

Advanced Inference with DNALLM

This tutorial is designed for users who are already familiar with Basic Inference and want to explore the more powerful and flexible features of the DNAInference engine. We will cover advanced topics such as batch processing, extracting internal model states, custom inference workflows, and advanced result handling.

1. Advanced Features Overview

The DNAInference engine is more than just a tool for getting predictions. It provides a suite of advanced capabilities for in-depth model analysis and integration into complex pipelines:

  • Direct Batch Inference: Process large datasets efficiently using batch_infer() for fine-grained control.
  • Model Introspection: Extract hidden states and attention weights to understand how the model makes its decisions.
  • Custom Workflows: Build tailored inference pipelines by directly using DNADataset and DataLoader.
  • Sequence Generation & Scoring: Use generative models like Evo for tasks beyond classification, such as creating new DNA sequences or scoring their likelihood.
  • Advanced Configuration: Fine-tune every aspect of the inference process for specific hardware and data characteristics.

2. Deep Dive into Batch Inference

While infer() is a convenient wrapper, batch_infer() is the workhorse method that gives you direct access to the model's raw outputs. This is useful when you need to implement custom post-processing or integrate with other ML frameworks.

The batch_infer() method returns three items: 1. all_logits: A raw tensor of model outputs before any activation function (like Softmax or Sigmoid) is applied. 2. predictions: A formatted dictionary of predictions (this is None if do_pred=False). 3. embeddings: A dictionary containing hidden states and/or attention weights if requested.

from dnallm import load_config, load_model_and_tokenizer, DNAInference

configs = load_config("inference_config.yaml")
model, tokenizer = load_model_and_tokenizer(
    "zhangtaolab/plant-dnagpt-BPE-promoter",
    task_config=configs["task"],
    source="modelscope",
)

inference_engine = DNAInference(
    model=model, tokenizer=tokenizer, config=configs
)

# 1. Generate a dataset and dataloader
sequences = ["GATTACA...", "CGCGCGC..."]
_, dataloader = inference_engine.generate_dataset(
    sequences, batch_size=configs["inference"].batch_size
)

# 2. Run batch inference, requesting hidden states and attentions
all_logits, _, embeddings = inference_engine.batch_infer(
    dataloader,
    do_pred=False,  # We'll process logits ourselves
    output_hidden_states=True,
    output_attentions=True,
)

# 3. Now you have the raw materials
print("Logits shape:", all_logits.shape)
# >> Logits shape: torch.Size([2, 2])

print("Hidden states available:", "hidden_states" in embeddings)
# >> Hidden states available: True

print("Attention weights available:", "attentions" in embeddings)
# >> Attention weights available: True

When to use batch_infer():

  • When you need raw logits for custom analysis (e.g., temperature scaling, ensemble methods).
  • When you only need embeddings and don't want the overhead of formatting predictions.
  • When integrating into a larger pipeline that has its own post-processing logic.

3. LoRA-Model Inference

The DNAInference engine seamlessly supports inference with models fine-tuned using LoRA adapters. This allows you to switch between different "personalities" of a base model without loading a completely new one.

To use a LoRA adapter, simply provide the path or hub ID to the lora_adapter argument during initialization.

from dnallm import load_config, load_model_and_tokenizer, DNAInference

# Load the config file
configs = load_config("inference_config.yaml")

# 1. Load the base model
base_model_name = "lgq12697/PlantCAD2-Small-l24-d0768"
model, tokenizer = load_model_and_tokenizer(
    base_model_name, task_config=configs["task"], source="modelscope"
)

# 2. Specify the LoRA adapter
lora_adapter_id = (
    "lgq12697/cross_species_acr_train_on_arabidopsis_plantcad2_small"
)

# 3. Initialize the engine with the adapter
# The engine will automatically download and apply the LoRA weights
lora_inference_engine = DNAInference(
    model=model,
    tokenizer=tokenizer,
    config=configs,
    lora_adapter=lora_adapter_id,
)

# Now, all inference calls will use the LoRA-adapted model
results = lora_inference_engine.infer(
    sequences=[
        "CTCTGCAATCATTGTCCAGAGTCGAGAAACCACCTCTTCTTCTCTTGTTCTTTCTCCAAATCGATTTGGT"
    ]
)
print(results)

This is extremely powerful for comparing a base model's performance against its fine-tuned variants or for deploying multiple specialized models efficiently.

4. Advanced Result Post-Processing

The DNAInference engine includes powerful visualization tools for model interpretability, which require output_attentions=True or output_hidden_states=True.

Visualizing Attention

plot_attentions() helps you see which parts of a sequence the model focused on.

# Run inference first with output_attentions=True
inference_engine.infer(sequences=sequences, output_attentions=True)

# Plot the attention map for the first sequence, last layer, and last head
attention_figure = inference_engine.plot_attentions(
    seq_idx=0, layer=-1, head=-1, save_path="./results/attention_map.png"
)

Visualizing Embeddings

plot_hidden_states() uses dimensionality reduction (t-SNE, PCA, UMAP) to visualize the sequence embeddings from each layer, which can reveal how the model separates different classes.

# Run inference first with output_hidden_states=True
inference_engine.infer(
    file_path="data/labeled_data.csv", output_hidden_states=True, evaluate=True
)

# Plot the embeddings using t-SNE
embedding_figure = inference_engine.plot_hidden_states(
    reducer="t-SNE", save_path="./results/embedding_plot.png"
)

Next, learn how to squeeze every drop of performance out of your hardware in the Performance Optimization guide.


Next Steps