Skip to content

Basic Inference with DNALLM

This tutorial walks you through the complete process of running inference using the DNAInference engine. We will cover loading a model, preparing data, and making predictions on both individual sequences and files.

1. The Core Workflow

The inference process in DNALLM follows these steps: 1. Load Configuration: Read the inference_config.yaml file. 2. Load Model & Tokenizer: Fetch a pre-trained model and its corresponding tokenizer. 3. Initialize DNAInference: Create an inference engine instance with the model, tokenizer, and config. 4. Run Inference: Use the engine's infer() method to get predictions. 5. Interpret Results: Analyze the output.

2. A Complete Example

Let's put everything together in a Python script. This example demonstrates loading a promoter prediction model and using it to classify DNA sequences.

import os
from dnallm import load_config, load_model_and_tokenizer, DNAInference


def main():
    # 1. Load Configuration
    # Assumes 'inference_config.yaml' is in the same directory
    try:
        configs = load_config("inference_config.yaml")
    except FileNotFoundError:
        print("Error: 'inference_config.yaml' not found. Please create it.")
        return

    # 2. Load Model and Tokenizer
    # This example uses a model from ModelScope. You can also use 'huggingface'.
    model_name = "zhangtaolab/plant-dnagpt-BPE-promoter"
    print(f"Loading model '{model_name}'...")
    model, tokenizer = load_model_and_tokenizer(
        model_name, task_config=configs["task"], source="modelscope"
    )

    # 3. Initialize DNAInference Engine
    print("Initializing inference engine...")
    inference_engine = DNAInference(
        model=model, tokenizer=tokenizer, config=configs
    )

    # --- 4. Run Inference ---

    # Example 1: Infer from a list of sequences
    print("\n--- Predicting from a list of sequences ---")
    seqs_list = [
        "GCACTTTACTTAAAGTAAAAAGAAAAAAACTGTGCGCTCTCCAACTACCGCAGCAACGTGTCGAGCACAGGAACACGTGTCACTTCAGTTCTTCCAATTGCTGGGGCCCACCACTGTTTACTTCTGTACAGGCAGGTGGCCATGCTGATGACACTCCACACTCCTCGACTTTCGTAGCAGCAAGCCACGCGTGACCGAGAAGCCTCGCG",
        "TTGTCATCACATTTGATCAACTACGATTTATGTTGTACTATTCATCTGTTTTCTCCTTTTTTTTTCCCTTATTGACAGGTTGTGGAGGTTCACAACGAACAGAATACAAGAAATTTTGGTAATCATTTGAGGACTTTCATGGGGTATGAATTGTGTGCTATAATAAATTAA",
    ]
    results_from_list = inference_engine.infer(sequences=seqs_list)
    print("Results:")
    print(results_from_list)

    # Example 2: Infer from a file
    print("\n--- Predicting from a file ---")
    # Create a dummy CSV file for demonstration
    seq_file = "test_data.csv"
    with open(seq_file, "w") as f:
        f.write("sequence,label\n")
        f.write(f"{seqs_list[0]},1\n")
        f.write(f"{seqs_list[1]},0\n")

    # Run inference and evaluation
    try:
        results_from_file, metrics = inference_engine.infer(
            file_path=seq_file,
            evaluate=True,  # Enable evaluation since the file has labels
            label_col="label",  # Specify the column containing labels
        )
        print("\nResults from file (first 2 entries):")
        print({k: results_from_file[k] for k in list(results_from_file)[:2]})

        print("\nEvaluation Metrics:")
        print(metrics)

    except FileNotFoundError:
        print(f"Error: The file '{seq_file}' was not found.")
    finally:
        # Clean up the dummy file
        if os.path.exists(seq_file):
            os.remove(seq_file)


if __name__ == "__main__":
    main()

After create the inference.py script, run the following code to do inference:

python inference.py

A user-friendly Jupyter Notebook is also provided: example/notebooks/inference/inference.ipynb.

3. Understanding the Output

The infer() method returns a dictionary where each key is the index of a sequence and the value contains its prediction details.

{
    "0": {
        "sequence": "GCACTTTACTTAAAGTA...",
        "label": "positive",
        "scores": {
            "negative": 0.02738,
            "positive": 0.97261
        }
    },
    "1": {
        "sequence": "TTGTCATCACATTTGAT...",
        "label": "negative",
        "scores": {
            "negative": 0.99983,
            "positive": 0.00016
        }
    }
}
  • sequence: The input DNA sequence (if keep_seqs is True during data loading).
  • label: The final predicted label, based on the task.threshold from your config. For a binary task, this would be one of the label_names.
  • scores: The raw probabilities for each class. This gives you a measure of the model's confidence.

If evaluate=True, a second dictionary containing performance metrics (like accuracy, F1-score, AUROC) is also returned.

4. Best Practices and Performance

Error Handling

  • FileNotFoundError: Always wrap file-based inference in a try...except block to handle cases where the input file doesn't exist.
  • OutOfMemoryError: If you get a CUDA out-of-memory error, the primary solution is to reduce batch_size in your inference_config.yaml.

Performance Optimization

  • Use a GPU: For any serious workload, a GPU is essential. Set device: auto or device: cuda.
  • Tune batch_size: Find the largest batch_size that fits in your GPU memory to maximize throughput.
  • Enable FP16/BF16: If you have a modern NVIDIA GPU (Ampere architecture or newer), setting use_fp16: true or use_bf16: true can provide a significant speedup with minimal impact on accuracy.
  • Increase num_workers: If you notice your GPU is often waiting for data, increasing num_workers can help speed up data loading, especially for large files.

5. Common Questions (FAQ)

Q: Why are my predictions all the same? A: This can happen if the model is not well-suited for your data or if the input sequences are too different from what it was trained on. Check that the model you loaded is appropriate for your task.

Q: How do I get hidden states or attention weights for model interpretability? A: The infer() method has output_hidden_states=True and output_attentions=True flags. Setting these will return embeddings and attention scores, which can be accessed via inference_engine.embeddings. Be aware that this consumes a large amount of memory.

Q: Can I run inference on a FASTA file? A: Yes. The infer_file method automatically handles .fasta, .fa, .csv, .tsv, and .txt files. For FASTA, the sequence is read directly. For CSV/TSV, you must specify the seq_col. Other structured formats such as pickle, arrow, parquet, etc. are also supported.


Next Steps