Skip to content

Sequence Mutation Analysis with DNALLM

This tutorial provides a comprehensive guide to performing in silico mutagenesis analysis using the dnallm.Mutagenesis class. This powerful tool allows you to systematically introduce mutations into a DNA sequence and evaluate their impact on a model's predictions, providing deep insights into sequence-function relationships and model interpretability.

We will cover: - Zero-shot Inference: Using pre-trained models without fine-tuning. - Mutation Analysis with Base Models: Scoring mutations with Masked Language Models (MLM) and Causal Language Models (CLM). - Mutation Analysis with Fine-tuned Models: Analyzing mutation effects on classification and regression tasks. - Specialized Models: Handling unique models like EVO for scoring.

Prerequisites: - Familiarity with Basic Inference. - An understanding of Advanced Inference concepts is helpful.

1. Zero-shot Inference Overview

Zero-shot inference is the ability of a large language model to perform tasks it was not explicitly trained for. In genomics, this means we can use a base, pre-trained model (like a CLM or MLM) to infer the "fitness" or "naturalness" of a DNA sequence without fine-tuning it on a specific labeled dataset.

The core idea is that a model trained on a vast corpus of genomic data has learned the underlying "grammar" of DNA. Sequences that are more "grammatical" or "likely" according to the model are often more biologically functional. The Mutagenesis class leverages this by measuring how much a mutation perturbs a sequence's likelihood score.

2. In Silico Mutagenesis Overview

In silico mutagenesis is the computational equivalent of saturation mutagenesis in the lab. Instead of physically creating and testing every possible mutation, we generate them computationally and use a trained model to predict their effects.

The dnallm.Mutagenesis class automates this process: 1. Mutation Generation: It takes a reference sequence and creates a dataset of mutated sequences, including single nucleotide substitutions, deletions, and insertions. 2. Model-based Scoring: It runs inference on the original and all mutated sequences. 3. Effect Calculation: It compares the prediction scores of mutated sequences to the original to quantify the impact of each mutation. 4. Visualization: It provides tools to plot the results as intuitive heatmaps and effect plots.

3. Mutation Analysis with Base Models (CLM & MLM)

Using pre-trained base models is a powerful zero-shot approach to identify functionally important regions in a sequence. The Mutagenesis class supports two primary scoring algorithms for this purpose.

Scoring with Masked Language Models (MLM)

For MLMs (e.g., DNABERT), we use a Pseudo-Log-Likelihood (PLL) score. The mlm_evaluate() method calculates this by: 1. Iterating through each token in the sequence. 2. Masking one token at a time. 3. Asking the model to predict the original token. 4. Summing the log-probabilities of the correct predictions.

A higher PLL score indicates the sequence is more "expected" by the model. A mutation that causes a large drop in PLL is likely deleterious.

Usage: Set task_type: "mask" in your configuration.

from dnallm import load_config, load_model_and_tokenizer, Mutagenesis

# Use a config with task_type: "mask"
configs = load_config("config_mlm.yaml")

model, tokenizer = load_model_and_tokenizer(
    "InstaDeepAI/nucleotide-transformer-500m-human-ref",
    task_config=configs["task"],
)

mut_analyzer = Mutagenesis(model=model, tokenizer=tokenizer, config=configs)

sequence = "GATTACA..."  # Your sequence of interest
mut_analyzer.mutate_sequence(sequence, replace_mut=True)

# The evaluate() method will automatically use mlm_evaluate()
predictions = mut_analyzer.evaluate()

mut_analyzer.plot(predictions, save_path="./results/mlm_mut_effects.pdf")

Scoring with Causal Language Models (CLM)

For CLMs (e.g., DNAGPT, Evo), we calculate the log-probability of the entire sequence. The clm_evaluate() method does this by: 1. Processing the sequence token by token. 2. At each position, calculating the log-probability of the correct next token given the preceding context. 3. Summing these log-probabilities.

This score represents how likely the model thinks the sequence is, from start to finish.

Usage: Set task_type: "generation" in your configuration.

# Use a config with task_type: "generation"
configs = load_config("config_clm.yaml")

model, tokenizer = load_model_and_tokenizer(
    "zhangtaolab/plant-dnagpt-BPE-promoter", task_config=configs["task"]
)

mut_analyzer = Mutagenesis(model=model, tokenizer=tokenizer, config=configs)

sequence = "AATATATTTAATCGGTGTATAATTTCTGTGAAGATCCTCGATACTTCATATAAGAGATTTTGAGAGAGAGAGAGAACCAATTTTCGAATGGGTGAGTTGGCAAAGTATTCACTTTTCAGAACATAATTGGGAAACTAGTCACTTTACTATTCAAAATTTGCAAAGTAGTC"
mut_analyzer.mutate_sequence(sequence, replace_mut=True)

# The evaluate() method will automatically use clm_evaluate()
predictions = mut_analyzer.evaluate()

mut_analyzer.plot(predictions, save_path="./results/clm_mut_effects.pdf")

4. Mutation Analysis with Fine-tuned Models

When you have a model fine-tuned for a specific task (e.g., predicting promoter strength), you can measure how mutations affect its output. This is a direct way to map sequence positions to functional outcomes.

The evaluate() method's strategy parameter is key here. It defines how the final "mutation effect score" is calculated from the model's output (which can be multi-dimensional for multi-class or multi-label tasks).

Score Normalization Strategies

The effect of a mutation is measured as the log2 fold change (logfc) between the mutated sequence's score and the original sequence's score. The strategy parameter determines which value from the logfc array to use as the final score for plotting.

  • strategy="last" (default): Uses the logfc of the last class. Ideal for binary or regression tasks.
  • strategy="first": Uses the logfc of the first class.
  • strategy="mean": Averages the logfc across all classes.
  • strategy="sum": Sums the logfc across all classes.
  • strategy=<int>: Uses the logfc at a specific class index.
  • strategy="max": Uses the logfc of the class that had the highest raw score in the original prediction.

Example: Regression Model

Let's analyze a model that predicts promoter strength (a regression task).

from dnallm import load_config, load_model_and_tokenizer, Mutagenesis

# Config for a regression task
configs = load_config("inference_config.yaml")

model, tokenizer = load_model_and_tokenizer(
    "zhangtaolab/plant-dnagpt-BPE-promoter_strength_protoplast",
    task_config=configs["task"],
    source="modelscope",
)

mut_analyzer = Mutagenesis(model=model, tokenizer=tokenizer, config=configs)

sequence = "AATATATTTAATCGGTGTATAATTTCTGTGAAGATCCTCGATACTTCATATAAGAGATTTTGAGAGAGAGAGAGAACCAATTTTCGAATGGGTGAGTTGGCAAAGTATTCACTTTTCAGAACATAATTGGGAAACTAGTCACTTTACTATTCAAAATTTGCAAAGTAGTC"
mut_analyzer.mutate_sequence(sequence, replace_mut=True)

# For regression, 'last' or 'mean' are good choices.
predictions = mut_analyzer.evaluate(strategy="mean")

mut_analyzer.plot(predictions, save_path="./results/finetuned_mut_effects.pdf")

5. Special Models (e.g., EVO)

The Mutagenesis class has built-in support for specialized generative models like Evo-1 and Evo-2. These models have their own optimized scoring methods.

When an Evo model is detected, mutagenesis.evaluate() automatically calls inference_engine.scoring() instead of the standard batch_infer(). The strategy parameter is passed to the reduce_method of the scoring function, typically with "mean" or "sum" being the most relevant options.

from dnallm import load_config, load_model_and_tokenizer, Mutagenesis

# Config for a generation task
configs = load_config("inference_evo_config.yaml")

# Load an Evo model
model, tokenizer = load_model_and_tokenizer(
    "lgq12697/evo2_1b_base", task_config=configs["task"], source="modelscope"
)

mut_analyzer = Mutagenesis(model=model, tokenizer=tokenizer, config=configs)

sequence = "GATTACAGATTACAGATTACA"
mut_analyzer.mutate_sequence(sequence, replace_mut=True)

# 'mean' or 'sum' are the most effective strategies for Evo models
predictions = mut_analyzer.evaluate(strategy="mean")

mut_analyzer.plot(predictions, save_path="./results/evo_mut_effects.pdf")

6. Troubleshooting

Problem: Slow Performance

  • Cause: Mutagenesis generates many sequences (len(seq) * 3 for substitutions).
  • Solution:
    • Ensure you are using a GPU (device: cuda).
    • Increase inference.batch_size in your config to the largest value that fits in VRAM.
    • For very long sequences, consider analyzing only a specific region of interest by passing a subsequence to mutate_sequence().

Problem: Out-of-Memory (OOM) Errors

  • Solution: Reduce batch_size. This is the most common fix. Start with a small value like 4 or 8 and increase it gradually.

Problem: Unexpected or Flat Scores

  • Check Model & Task Type: Ensure the task_type in your config matches the model you are using. Using a regression config with a base MLM model will not produce meaningful results.
  • Check Sequence Length: If your sequence is much longer than the model's max_length, it will be truncated, and mutations outside the context window will have no effect.
  • Model Sensitivity: Some models may not be sensitive to single-nucleotide changes. This is an insight in itself! You might need a model with higher resolution or one fine-tuned on a relevant task.

Next Steps