MCP Server Usage Guide¶
This guide covers how to use the DNALLM MCP server, including API reference, client examples, and practical usage patterns.
Overview¶
The DNALLM MCP server provides DNA sequence analysis capabilities through the Model Context Protocol (MCP). It supports multiple transport protocols and offers both basic and streaming prediction modes.
Available Tools¶
Basic Prediction Tools¶
dna_sequence_predict¶
Predict a single DNA sequence using a specific model.
Parameters:
- sequence (string): DNA sequence to analyze (A, T, G, C only)
- model_name (string): Name of the model to use
Returns: - Prediction results with confidence scores and labels
Example:
{
"sequence": "ATCGATCGATCG",
"model_name": "promoter_model",
"result": {
"prediction": "Core promoter",
"confidence": 0.85,
"probabilities": {
"Not promoter": 0.15,
"Core promoter": 0.85
}
}
}
dna_batch_predict¶
Predict multiple DNA sequences using a single model.
Parameters:
- sequences (array): List of DNA sequences to analyze
- model_name (string): Name of the model to use
Returns: - Batch prediction results for all sequences
Example:
{
"sequences": ["ATCGATCG", "GCTAGCTA", "TTAACCGG"],
"model_name": "promoter_model",
"results": [
{
"sequence": "ATCGATCG",
"prediction": "Core promoter",
"confidence": 0.85
},
{
"sequence": "GCTAGCTA",
"prediction": "Not promoter",
"confidence": 0.72
},
{
"sequence": "TTAACCGG",
"prediction": "Core promoter",
"confidence": 0.91
}
]
}
dna_multi_model_predict¶
Predict a single sequence using multiple models for comparison.
Parameters:
- sequence (string): DNA sequence to analyze
- model_names (array, optional): List of model names to use (uses all loaded models if not specified)
Returns: - Multi-model prediction results with consensus analysis
Example:
{
"sequence": "ATCGATCGATCG",
"model_names": ["promoter_model", "conservation_model"],
"results": {
"promoter_model": {
"prediction": "Core promoter",
"confidence": 0.85
},
"conservation_model": {
"prediction": "Conserved",
"confidence": 0.92
}
},
"consensus": {
"promoter_consensus": "Core promoter",
"conservation_consensus": "Conserved",
"overall_confidence": 0.88
}
}
Streaming Tools (Real-time Progress)¶
dna_stream_predict¶
Stream single sequence prediction with real-time progress updates.
Parameters:
- sequence (string): DNA sequence to analyze
- model_name (string): Name of the model to use
- stream_progress (boolean, optional): Enable progress streaming (default: true)
Returns: - Streaming prediction results with progress updates
Progress Updates: - 0%: Starting prediction - 25%: Loading model and tokenizer - 75%: Processing prediction results - 100%: Prediction completed
dna_stream_batch_predict¶
Stream batch prediction with progress updates.
Parameters:
- sequences (array): List of DNA sequences to analyze
- model_name (string): Name of the model to use
- stream_progress (boolean, optional): Enable progress streaming (default: true)
Returns: - Streaming batch prediction results with per-sequence progress
dna_stream_multi_model_predict¶
Stream multi-model prediction with progress updates.
Parameters:
- sequence (string): DNA sequence to analyze
- model_names (array, optional): List of model names to use
- stream_progress (boolean, optional): Enable progress streaming (default: true)
Returns: - Streaming multi-model prediction results with per-model progress
Model Management Tools¶
list_loaded_models¶
List all currently loaded models with their information.
Parameters: None
Returns: - List of loaded models with metadata
Example:
{
"loaded_models": [
{
"name": "promoter_model",
"display_name": "Plant DNABERT BPE promoter",
"task_type": "binary",
"num_labels": 2,
"architecture": "DNABERT",
"tokenizer": "BPE",
"performance": {
"accuracy": 0.85,
"f1_score": 0.82
}
}
]
}
get_model_info¶
Get detailed information about a specific model.
Parameters:
- model_name (string): Name of the model
Returns: - Detailed model information including configuration and performance metrics
list_models_by_task_type¶
List models filtered by task type.
Parameters:
- task_type (string): Task type to filter by ("binary", "multiclass", "regression", "token")
Returns: - List of models matching the specified task type
get_all_available_models¶
Get information about all available models (not just loaded ones).
Parameters: None
Returns: - Complete list of available models from model_info.yaml
health_check¶
Perform health check on the MCP server.
Parameters: None
Returns: - Server health status and statistics
Example:
from dnallm.mcp import DNALLMMCPClient
# Connect using streamable-http transport (recommended)
client = DNALLMMCPClient(transport="streamable-http", url="http://localhost:8000/mcp")
# Single sequence prediction
result = client.dna_sequence_predict("ATCGATCG", "dnabert-2")
print(result)
Python with Pydantic AI¶
import asyncio
from pydantic import BaseModel
from pydantic_ai import Agent
from pydantic_ai.models.openai import OpenAIChatModel
from pydantic_ai.providers.ollama import OllamaProvider
from pydantic_ai.mcp import MCPServerStreamableHTTP
# Create MCP server connection
server = MCPServerStreamableHTTP("http://localhost:8000/mcp")
# Create agent with MCP server tools
agent = Agent(
OpenAIChatModel(
model_name="qwen3:latest",
provider=OllamaProvider(base_url="http://localhost:11434/v1"),
),
toolsets=[server],
system_prompt="""You are a DNA analysis assistant with access to specialized DNA analysis tools via MCP server.
When analyzing a DNA sequence, you should:
1. First call _list_loaded_models to see what models are available
2. Then call dna_multi_model_predict with the DNA sequence and appropriate model names
3. Interpret and explain the results in a comprehensive way
Available tools should include:
- _list_loaded_models: Lists available DNA analysis models
- dna_multi_model_predict: Predicts DNA sequence properties using multiple models
Always use the tools to provide accurate analysis.""",
)
# Analyze DNA sequence
async def analyze_dna_sequence():
async with agent:
result = await agent.run(
"What is the function of following DNA sequence? Please analyze it thoroughly using all available models: AGAAAAAACATGACAAGAAATCGATAATAATACAAAAGCTATGATGGTGTGCAATGTCCGTGTGCATGCGTGCACGCATTGCAACCGGCCCAAATCAAGGCCCATCGATCAGTGAATACTCATGGGCCGGCGGCCCACCACCGCTTCATCTCCTCCTCCGACGACGGGAGCACCCCCGCCGCATCGCCACCGACGAGGAGGAGGCCATTGCCGGCGGCGCCCCCGGTGAGCCGCTGCACCACGTCCCTGA"
)
return result
# Run the analysis
result = await analyze_dna_sequence()
print(result.output)
Python with MCP Client¶
import asyncio
from mcp import ClientSession, StdioServerParameters
from mcp.client.stdio import stdio_client
async def main():
# Connect to MCP server via STDIO
server_params = StdioServerParameters(command="dnallm-mcp-server")
async with stdio_client(server_params) as (read, write):
async with ClientSession(read, write) as session:
# Initialize the session
await session.initialize()
# List available models
models = await session.call_tool("list_loaded_models", {})
print(f"Available models: {models}")
# Predict DNA sequence
result = await session.call_tool(
"dna_sequence_predict",
{"sequence": "ATCGATCGATCG", "model_name": "promoter_model"},
)
print(f"Prediction result: {result}")
# Multi-model prediction
multi_result = await session.call_tool(
"dna_multi_model_predict",
{
"sequence": "ATCGATCGATCG",
"model_names": ["promoter_model", "conservation_model"],
},
)
print(f"Multi-model result: {multi_result}")
if __name__ == "__main__":
asyncio.run(main())
Python with SSE Client¶
import asyncio
from mcp.client.sse import sse_client
async def main():
# Connect to SSE server
async with sse_client("http://localhost:8000/sse") as (read, write):
# List available models
models = await read.call_tool("list_loaded_models", {})
print(f"Available models: {models}")
# Test streaming prediction
result = await read.call_tool(
"dna_stream_predict",
{
"sequence": "ATCGATCGATCG",
"model_name": "promoter_model",
"stream_progress": True,
},
)
print(f"Streaming prediction result: {result}")
if __name__ == "__main__":
asyncio.run(main())
JavaScript/Node.js Client¶
const { EventSource } = require('eventsource');
// Connect to SSE server
const eventSource = new EventSource('http://localhost:8000/sse');
eventSource.onmessage = function(event) {
const data = JSON.parse(event.data);
console.log('Received:', data);
};
// Send MCP tool call
async function callTool(toolName, arguments) {
const response = await fetch('http://localhost:8000/mcp/messages/?session_id=test', {
method: 'POST',
headers: {
'Content-Type': 'application/json',
},
body: JSON.stringify({
jsonrpc: "2.0",
id: 1,
method: "tools/call",
params: {
name: toolName,
arguments: arguments
}
})
});
return await response.json();
}
// Example usage
callTool("list_loaded_models", {})
.then(result => console.log("Models:", result))
.catch(error => console.error("Error:", error));
callTool("dna_sequence_predict", {
sequence: "ATCGATCGATCG",
model_name: "promoter_model"
})
.then(result => console.log("Prediction:", result))
.catch(error => console.error("Error:", error));
cURL Examples¶
Health Check¶
curl -X POST "http://localhost:8000/mcp/messages/?session_id=test" \
-H "Content-Type: application/json" \
-d '{"jsonrpc": "2.0", "id": 1, "method": "tools/call", "params": {"name": "health_check", "arguments": {}}}'
List Models¶
curl -X POST "http://localhost:8000/mcp/messages/?session_id=test" \
-H "Content-Type: application/json" \
-d '{"jsonrpc": "2.0", "id": 1, "method": "tools/call", "params": {"name": "list_loaded_models", "arguments": {}}}'
Single Sequence Prediction¶
curl -X POST "http://localhost:8000/mcp/messages/?session_id=test" \
-H "Content-Type: application/json" \
-d '{"jsonrpc": "2.0", "id": 1, "method": "tools/call", "params": {"name": "dna_sequence_predict", "arguments": {"sequence": "ATCGATCGATCG", "model_name": "promoter_model"}}}'
Batch Prediction¶
curl -X POST "http://localhost:8000/mcp/messages/?session_id=test" \
-H "Content-Type: application/json" \
-d '{"jsonrpc": "2.0", "id": 1, "method": "tools/call", "params": {"name": "dna_batch_predict", "arguments": {"sequences": ["ATCGATCG", "GCTAGCTA"], "model_name": "promoter_model"}}}'
Multi-Model Prediction¶
async def basic_dna_analysis(sequence):
async with sse_client("http://localhost:8000/sse") as (read, write):
# 1. Check available models
models = await read.call_tool("list_loaded_models", {})
print(f"Available models: {models}")
# 2. Single model prediction
result = await read.call_tool(
"dna_sequence_predict",
{"sequence": sequence, "model_name": "promoter_model"},
)
print(f"Promoter prediction: {result}")
# 3. Multi-model analysis
multi_result = await read.call_tool("dna_multi_model_predict", {"sequence": sequence})
print(f"Multi-model analysis: {multi_result}")
return multi_result
2. Batch Processing Workflow¶
async def batch_dna_analysis(sequences):
async with sse_client("http://localhost:8000/sse") as (read, write):
# Process sequences in batches
batch_size = 10
results = []
for i in range(0, len(sequences), batch_size):
batch = sequences[i : i + batch_size]
# Use streaming for progress updates
result = await read.call_tool(
"dna_stream_batch_predict",
{
"sequences": batch,
"model_name": "promoter_model",
"stream_progress": True,
},
)
results.extend(result.get("results", []))
return results
3. Real-time Analysis with Progress¶
async def real_time_analysis(sequence):
async with sse_client("http://localhost:8000/sse") as (read, write):
# Use streaming prediction for real-time updates
result = await read.call_tool(
"dna_stream_predict",
{
"sequence": sequence,
"model_name": "promoter_model",
"stream_progress": True,
},
)
# Process streaming results
if result.get("streamed"):
print("Prediction completed with progress updates")
return result
4. Model Comparison Workflow¶
async def model_comparison(sequence):
async with sse_client("http://localhost:8000/sse") as (read, write):
# Get all available models
models = await read.call_tool("list_loaded_models", {})
model_names = [model["name"] for model in models["loaded_models"]]
# Compare all models
comparison = await read.call_tool(
"dna_multi_model_predict",
{"sequence": sequence, "model_names": model_names},
)
# Analyze consensus
results = comparison.get("results", {})
consensus = comparison.get("consensus", {})
print(f"Model comparison for sequence: {sequence}")
for model_name, result in results.items():
print(f"{model_name}: {result['prediction']} (confidence: {result['confidence']:.3f})")
print(f"Consensus: {consensus}")
return comparison
Error Handling¶
Common Error Responses¶
{
"error": "Model promoter_model not available or prediction failed",
"isError": true
}
{
"error": "Invalid DNA sequence: contains invalid characters",
"isError": true
}
{
"error": "Model not found: unknown_model",
"isError": true
}
Error Handling in Python¶
async def safe_prediction(sequence, model_name):
try:
async with sse_client("http://localhost:8000/sse") as (read, write):
result = await read.call_tool(
"dna_sequence_predict",
{"sequence": sequence, "model_name": model_name},
)
if result.get("isError"):
print(f"Prediction error: {result.get('error')}")
return None
return result
except Exception as e:
print(f"Connection error: {e}")
return None
Performance Tips¶
1. Batch Processing¶
- Use
dna_batch_predictfor multiple sequences - Process sequences in batches of 10-50 for optimal performance
- Use streaming for progress updates on large batches
2. Model Selection¶
- Use faster models (DNAMamba) for real-time applications
- Use more accurate models (DNABERT) for critical analysis
- Consider model-specific optimizations
3. Memory Management¶
- Monitor memory usage with large batches
- Use appropriate batch sizes for your hardware
- Consider CPU inference for memory-constrained environments
4. Network Optimization¶
- Use local models when possible
- Enable compression for SSE connections
- Use appropriate connection timeouts
Next Steps¶
- Configuration Guide for advanced setup
- Troubleshooting for common issues
- API Reference for detailed documentation